20  extract the drive letter from a windows path

TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot

TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot

Ngày tải lên : 06/03/2014, 10:20
... AVAILABLE AT TIME OF RANDOMIZATION Client savings balance (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard deviation of balances in barangay (hundreds) ... visit from the Bank “Active” (row 2) defined as having had a transaction in their account in the past six months Mean balances of savings accounts include empty accounts Barangays are the smallest ... to the new product Although the nominal amounts are small, as a percentage of prior formal bank savings the product impact is significant The average amounts saved are also economically significant:...
  • 38
  • 523
  • 0
The Economic Crisis from a Neoclassical Perspective pptx

The Economic Crisis from a Neoclassical Perspective pptx

Ngày tải lên : 08/03/2014, 06:20
... appears to be much more distorted than the aggregate capital market in that the labor deviation is consistently larger than the capital deviation And this capital deviation is a natural measure ... earlier Recall that the capital deviation is equivalent to capital market imperfections that drive a wedge between the return paid to the suppliers of capital and the cost of capital paid by the users ... crisis was itself the major factor in the recession To causally connect the financial crisis with the recession, the financial view emphasizes that in the past, financial crises have been associated...
  • 22
  • 835
  • 0
Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf

Báo cáo y học: "Where does the lactate come from? A rare cause of reversible inhibition of mitochondrial respiration" pdf

Ngày tải lên : 13/08/2014, 20:21
... lactate/pyruvate and acetoacetate/ β-hydroxybutyrate ratios, as reflections of cytoplasmic and mitochondrial redox states, were unavailable Interestingly, there was a clear correlation between drug clearance, ... literature, pure hypoxic causes of lactic acidosis are relatively rare in clinical practice In the case of biguanide-induced lactic acidosis, the fact that the inhibition of mitochondrial respiration ... Dalakas MC: Mitochondrial toxicity of antiviral drugs Nat Med 1995, 1:417-422 14 Peters N, Jay N, Barraud D, Cravoisy A, Nace L, Bollaert PE, Gibot S: Metforminassociated lactic acidosis in an...
  • 2
  • 233
  • 0
conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

conference interpreting in the vietnamese context from a pragmatic perspective = nghiên cứu phiên dịch hội nghị trong bối cảnh việt nam từ quan điểm dụng học

Ngày tải lên : 02/03/2015, 14:17
... Interpreting vs translation Interpreting is generally regarded as a translational activity, as a special form of ‘Translation' (the capital initial is used to indicate that the word appears in its generic ... processing approach (CP paradigm), neurolinguistic (NL paradigm), translation-theoretical (TT paradigm), and dialogic discourse-based interaction (DI paradigm) The details of these paradigms are described ... products) approaches because the database only is insufficient to make progress towards a real explanatory theory The primary design of the study is the application and testing of the pragmatic cognitive...
  • 272
  • 657
  • 5
Exploring the environmental variable from a cultural perspective through wayfinding behavior based on three chinese hospitals case studies

Exploring the environmental variable from a cultural perspective through wayfinding behavior based on three chinese hospitals case studies

Ngày tải lên : 05/10/2015, 22:31
... traditional Chinese is quite broad and complex The physical features of axiality and cardinal orientation, the courtyard are selected here because they are typical and inevitably discussed by almost all ... traditional architectural principles, such as axiality and cardinal orientation, the courtyard There are no obvious particularities in physical features compared to other traditional buildings Therefore, ... observe and quantify the wayfinding behaviors of our subjects Then the data of wayfinding behaviors will be tested against the environmental variables analyzed from a cultural perspective The purpose...
  • 161
  • 284
  • 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx

Ngày tải lên : 16/03/2014, 06:20
... CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC GCATCTTCTCCGTAGATCGATAATGCTGC ... CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC ... mutational analysis of the active-site residues Mutation Primer sequence (5Â- to 3Â) Type R2 7A CTGGACATCGCCGCGCATTTTTATTCAC GTGAATAAAAATGCGCGGCGATGTCCAG GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC...
  • 13
  • 311
  • 0
Báo cáo toán học: "On the h-Vector of a Lattice Path Matroid" pot

Báo cáo toán học: "On the h-Vector of a Lattice Path Matroid" pot

Ngày tải lên : 08/08/2014, 01:20
... k Ai is a partial transversal of A if there exists an injection φ : T → [k] such i=1 that t ∈ A (t) for all t ∈ T The partial transversals of A are the independent sets of the transversal matroid ... simplification of our original proof.) Let A, A, C, and Γ be as in Theorem 3.6, and set A+ = {a1 + 1, a2 + 1, , ar + 1} By Remark 3.5, the path A+ does not cross the path σC It is clear that the ... hr ) be the h-vector of M (A) Then for all i, hi is the number of lattice paths between A and σC that have exactly i loose steps Remark 3.5 In general, a rank-r matroid M with coloop e has (h0...
  • 6
  • 499
  • 0
Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Báo cáo khoa học: "Injurious mechanical ventilation in the normal lung causes a progressive pathologic change in dynamic alveolar mechanics" potx

Ngày tải lên : 13/08/2014, 03:21
... outlined and the area at peak inspiration (I) and end expiration (E) was measured using image analysis software Alveolar stability was assessed by the percentage change in the area of individual alveoli ... fields were analyzed in each animal at each timepoint A mean of 38 alveoli (range 8–65) per timepoint per animal was analyzed The large range was due to alveolar collapse (atelectasis) in the HP/LP ... that they are not completely surrounded by other alveoli In other words, one wall of a subpleural alveolus is always adjacent to the visceral pleura rather than another alveolus This anatomic arrangement...
  • 9
  • 277
  • 0
Phonetics Choose one word whose underlined part is pronounced differently from the others. Identify your answer by circling the corresponding letter A, B, C, or D:

Phonetics Choose one word whose underlined part is pronounced differently from the others. Identify your answer by circling the corresponding letter A, B, C, or D:

Ngày tải lên : 30/01/2015, 21:22
... candy A earning A pays A given A cough 10 A accident A this A gas A bought A spear 11 12 13 14 15 A forks A handed A car A within A has 16 17 18 19 20 A drunkard A kites A student A wealth A brilliant ... 161 A book 162 A hate 163 A thank 164 A noon 165 A chorus 166 A Italy 167 A say 168 A language 169 A print 170 A English 171 A study 172 A official 173 A language 174 A English 175 A China 176 A ... energy 64 A export 65 A plant 66 A nuclear 67 A dollar 68 A food 69 A force 70 A earth 71 A nest 72 A sunrise 73 A worried 74 A physical 75 A advance 76 A pneumonia 77 A world 78 A meat 79 A mankind...
  • 9
  • 7.7K
  • 23
The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

The phenomenon of evaporative cooling from a humid surface as an alternative method for air-conditioning

Ngày tải lên : 05/09/2013, 16:10
... cooler, the main parameter when designing an indirect system is the heat-exchange surface that separates the air stream from the water to be evaporated These surfaces absorb heat from the primary air ... when the air and water temperature reach the same value, called “adiabatic saturation temperature”, being the process known as “adiabatic saturation” To define this temperature we can suppose a ... 1) The adiabatic saturation temperature, Tad sat, is the temperature that the air reaches when gets to the output of the tunnel, if water is provided and evaporated at that temperature Isolation...
  • 28
  • 652
  • 0
Displaying an Image from a Database in a Windows Forms Control

Displaying an Image from a Database in a Windows Forms Control

Ngày tải lên : 28/10/2013, 18:15
... CurrencyManager notifies all data-bound controls if the current item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains the ... that are bound to the same data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a ... BindingManagerBase bm; // private void DisplayDatabaseImageForm_Load(object sender, System.EventArgs e) { // Create the DataSet ds = new DataSet( ); // Create the DataAdapter and retrieve the Employees...
  • 5
  • 391
  • 0
Getting the Most from a Class Discussion Group

Getting the Most from a Class Discussion Group

Ngày tải lên : 02/11/2013, 18:20
... secretary writes down what each person says and reads back the notes to the group after everyone has spoken GETTING THE MOST FROM A CLASS DISCUSSION GROUP • A reporter tells the class what the ... tell her what you thought she said and then ask her if that was what she meant As you are speaking, repeat a word or phrase that she used Pay close attention to her response as you speak If she ... than they speak, there’s a good chance she didn’t say quite what she thought she said—or what she meant was different from what she said By telling someone what you heard, you are helping avoid...
  • 6
  • 503
  • 0
Getting the Most from a Lecture

Getting the Most from a Lecture

Ngày tải lên : 02/11/2013, 18:20
... to use class participation for all or part of their instruction Many students don’t like class participation, either because they’d rather hear what the teacher has to say than what their fellow ... speaking in class because they’re afraid they’ll make some kind of mistake Aside from the fact that some teachers require participation, and grade accordingly, once you accept yourself as a bona ... THE LECTURE CLASS Many schools and companies have lecture halls that can accommodate fifty or more students Seats may or may not be assigned Before you attend class, you can probably find out from...
  • 16
  • 433
  • 1
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

Ngày tải lên : 18/12/2013, 10:08
... 16 AN ANALYSIS OF THE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A Apart from the formal salutation at the beginning and farewell at the end, the ... one another, and must always remember that even the unwanted have worth (81) And our country must abandon all the habits of racism, because we cannot carry the message of freedom and the baggage ... is the part where Theme is developed and it lies in the remainder of the clause Normally, the choice of Theme reveals the meaning of the clause, more particularly the thematic meaning that clause...
  • 44
  • 578
  • 0
Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Tài liệu Activity 7.2: Determining the Impact of Technology on a Windows DNA Design docx

Ngày tải lên : 21/12/2013, 06:16
... Tools Data Access Data Storage Security After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flipchart THIS PAGE INTENTIONALLY ... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems ... by the instructor Identify the level of impact — high, medium, or low — that each technology type would have on the given layer of a Windows DNA design Write your answers in the grid provided After...
  • 4
  • 631
  • 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf

Tài liệu Using the Data Form Wizard to Create a Windows Form phần 1 pdf

Ngày tải lên : 24/12/2013, 01:17
... you'll use the Data Form Wizard to create a form that accesses the Customers and Orders tables in the Northwind database: Select Project ➣ Add New Item Select Data Form Wizard from the Templates section ... the right, enter the Name of the form as MyDataForm.cs, and click Open (see Figure 6.18) You'll then see the welcome page for the Data Form Wizard Figure 6.18: Adding a data form using the Data ... Choosing the data connection Click the Next button to continue You now log in to the database by specifying the password for the database user You used the sa user when creating the database connection...
  • 5
  • 502
  • 0
Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc

Tài liệu Using the Data Form Wizard to Create a Windows Form phần 2 doc

Ngày tải lên : 24/12/2013, 01:17
... and add the following Main() method inside your MyDataForm class (a good place to add Main() would be at the start of your MyDataForm class after the open curled bracket {): public class MyDataForm ... own forms that access the database Follow these steps to add a label and a text box to your form: Add a label below the Address label in your form Set the Name property for your new label to lblCity ... is the Orders table The rows for the child table are displayed in a DataGrid control o o o o o Cancel All The Cancel All button allows you to undo any changes you've made to the current row Add...
  • 7
  • 444
  • 0
Tài liệu Creating a Table in the Database from a DataTable Schema docx

Tài liệu Creating a Table in the Database from a DataTable Schema docx

Ngày tải lên : 21/01/2014, 11:20
... database, you can iterate through the collection of DataRelation objects for the DataSet and use the ALTER TABLE statement with the ADD CONSTRAINT command and a FOREIGN KEY argument to add the ... of the EXISTS query to the calling application and use that to control whether the new table is created The second DDL command uses the CREATE TABLE statement to create the table in the database ... primary keys can easily be added to the CREATE TABLE command, the easiest way to handle compound keys is by using an ALTER TABLE statement with an ADD CONSTRAINT statement and PRIMARY KEY argument...
  • 6
  • 493
  • 0
Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt

Tài liệu Hyperlink from a Row in the Data Grid to a Detail Page ppt

Ngày tải lên : 21/01/2014, 12:20
... and run the Visual Basic NET-Chapter solution From the main page, click on the hyperlink with the caption How-To 5.8: Hyperlink From a Row in the Data Grid to a Detail Page You then see all the ... the Columns tab and set the properties as displayed in Figure 5.14 Be sure to note the name of the form you are calling in the URL Format String so that you can name it the same in step Add the ... 5.30 to the Load event of the page Listing 5.30 wfrmHowTo5_ 8a. aspx.vb: Filling and Binding the Products to the DataGrid Object Private Sub Page_Load(ByVal sender As System.Object, ByVal e As System.EventArgs)...
  • 5
  • 392
  • 0